While Anthropic's dispute with the Pentagon escalated over guardrails on military use, OpenAI LLC struck its own publicized ...

This valuable work identifies a subpopulation of neurons in the larval zebrafish pallium that responds differentially to varying threat levels, potentially mediating the categorization of negative ...

When Nandakishore Leburu was building LLM applications at LinkedIn, he learned that the models weren't the problem. The ...

Service providers must optimize three compression variables simultaneously: video quality, bitrate efficiency/processing power and latency ...

Modality-agnostic decoders leverage modality-invariant representations in human subjects' brain activity to predict stimuli irrespective of their modality (image, text, mental imagery).

MicroPython is a well-known and easy-to-use way to program microcontrollers in Python. If you’re using an Arduino Uno Q, ...

A group of hackers used both Claude Code and ChatGPT in a cybersecurity hack that lasted two and a half months.

Neural encoding is the study of how neurons represent information with electrical activity (action potentials) at the level of individual cells or in networks of neurons. Studies of neural encoding ...

BACKGROUND: Genetic variants in components or regulators of the RAS-MAPK signaling pathway are causative for severe and early-onset hypertrophic cardiomyopathy (HCM) in patients with Noonan syndrome ...

A reverse primer designed from EST aa306952 (5′–CGTAACACTCCATGGAAATCAGC–3′) and a forward primer designed from the ORF upstream to EST aa306952 (5′–ATGAAGGATGTTATGTCAGCTCTGT–3′) were used to amplified ...

We’ve put together some practical python code examples that cover a bunch of different skills. Whether you’re brand new to ...